| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:41:16 |
| Analysis completed | 2025-04-03 05:41:16 |
| Wall time | 0:0:0 hours |
| locus | matK |
| preliminary_id | Planta |
| taxa_of_interest |
Nicotiana tabacum |
| country | Indonesia |
| host | NA |
| sample_id | MP23-0432_matK |
| Query DNA sequence |
>MP23-0432_matK ATATCCGACCAAACCTATCAATAATATCAGAATCTGACAAATCGGCCCAAACTGGTTTAC TAATAGGATTCCCCGATACGTTACAAAATTTCGCTTTTGACAATGATCCAACCATAGAAA TAATTGGAACTATAGTTTCGAATTTTTTAGTAACAGTATCTATTAAAAAAGAATTCTCTA GCATTTGACTCTTTACCGCTGAAGGATTTATTGGTACACTTGAAAGATAACCCAGAAAAT GGAAAGAAAAATTTGAGAATTGGTTTATGTGGATCCTACAGGGTTGAGACCAAAAGTGAA AATGACATTGCCAAAAATTGACAAAGTAAGATTTCCATTTCTTCATCAGAAGACGAGTCC CTTTTGAAACCAGAATTGATTTTCCTTGATATCTAACATAATGCATGAAAGGATCCTTGA GCAACCATAGGGTTTTCTGAAAATCATTACAACAAAGTACTACGAGATGTTGTTCTATTT TTTCATGGAAATGTGTTCGCTCAAGAAAGGTTCCAGAAGATGTTGATCGTAAATAAGAGG ATTGTTTACGGAGAAAAACAAATATGGATTCGCATTCAACCACATAAGAATTATATAGGA ACAAAAAGAGTCTTGGATTCTCTTTTGAAAAACCATAATAGTTAGATTTCTTTGGAGTAA TAAGATTATTCCAATTATGATATTCGTGAAAAAAGAATCGTAATAAATGTAAAGAGGGAA CATCTTGTATCCAGCATT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
| Taxa of interest ruled out | False |
|
Flag 2A: Taxon of interest NOT detected Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 22 | 14 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Xanthosoma mafaffa | 1 | 100.0% | 0.0 |
| Caladium praetermissum | 1 | 100.0% | 0.0 |
| Xanthosoma sagittifolium | 4 | 100.0% | 0.0 |
| Xanthosoma brasiliense | 1 | 100.0% | 0.0 |
| Colocasia esculenta | 3 | 100.0% | 0.0 |
| Xanthosoma robustum | 1 | 100.0% | 0.0 |
| Alocasia cucullata | 1 | 99.9% | 0.0 |
| Xanthosoma mexicanum | 2 | 99.7% | 0.0 |
| Chlorospatha sp. Chase 11912 | 1 | 99.2% | 0.0 |
| Xanthosoma helleborifolium | 2 | 99.1% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | DQ401357 | Xanthosoma mafaffa maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 738.0 | 0.00e+00 | 100.0% |
| 2 | NC_068799 | Caladium praetermissum isolate XLMRHYY chloroplast, complete genome | 738 | 100.0% | 738.0 | 0.00e+00 | 100.0% |
| 3 | MW628970 | Xanthosoma sagittifolium chloroplast, complete genome | 738 | 100.0% | 738.0 | 0.00e+00 | 100.0% |
| 4 | GU135019 | Xanthosoma sagittifolium voucher J.R. Abbott 24707 (FLAS) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 738.0 | 0.00e+00 | 100.0% |
| 5 | EU542591 | Xanthosoma brasiliense maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 738.0 | 0.00e+00 | 100.0% |
| 6 | JQ586607 | Colocasia esculenta voucher BioBot05993 maturase K (matK) gene, partial cds; chloroplast | 718 | 97.3% | 718.0 | 0.00e+00 | 100.0% |
| 7 | JQ586608 | Colocasia esculenta voucher BioBot05994 maturase K (matK) gene, partial cds; chloroplast | 718 | 97.3% | 718.0 | 0.00e+00 | 100.0% |
| 8 | JQ586606 | Colocasia esculenta voucher BioBot05992 maturase K (matK) gene, partial cds; chloroplast | 716 | 97.0% | 716.0 | 0.00e+00 | 100.0% |
| 9 | OQ290129 | Xanthosoma robustum voucher Anastasio Sotero 20963 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 709 | 96.1% | 709.0 | 0.00e+00 | 100.0% |
| 10 | EU886500 | Xanthosoma sagittifolium tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 735.0 | 0.00e+00 | 99.9% |
| 11 | NC_060696 | Alocasia cucullata chloroplast, complete genome | 738 | 100.0% | 735.0 | 0.00e+00 | 99.9% |
| 12 | PP913817 | Xanthosoma sagittifolium isolate QNY2 maturase K (matK) gene, partial cds; chloroplast | 727 | 98.5% | 724.0 | 0.00e+00 | 99.9% |
| 13 | JQ586655 | Xanthosoma mexicanum voucher BioBot02172 maturase K (matK) gene, partial cds; chloroplast | 718 | 97.3% | 712.0 | 0.00e+00 | 99.7% |
| 14 | JQ586654 | Xanthosoma mexicanum voucher BioBot02171 maturase K (matK) gene, partial cds; chloroplast | 718 | 97.3% | 712.0 | 0.00e+00 | 99.7% |
| 15 | AM920613 | Chlorospatha sp. Chase 11912 plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 720.0 | 0.00e+00 | 99.2% |
| 16 | NC_051873 | Xanthosoma helleborifolium voucher MO:103054 chloroplast, complete genome | 738 | 100.0% | 717.0 | 0.00e+00 | 99.1% |
| 17 | EU542592 | Zomicarpa steigeriana maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 715.0 | 0.00e+00 | 98.9% |
| 18 | AM920612 | Xanthosoma helleborifolium plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 714.0 | 0.00e+00 | 98.9% |
| 19 | JQ586657 | Xanthosoma wendlandii voucher BioBot00148 maturase K (matK) gene, partial cds; chloroplast | 718 | 97.3% | 694.0 | 0.00e+00 | 98.9% |
| 20 | JQ586658 | Xanthosoma wendlandii voucher BioBot00149 maturase K (matK) gene, partial cds; chloroplast | 717 | 97.2% | 693.0 | 0.00e+00 | 98.9% |
| 21 | EU542584 | Chlorospatha atropurpurea maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 711.0 | 0.00e+00 | 98.6% |
| 22 | MN006729 | Syngonium podophyllum voucher CCMB-29-124-SV5 maturase K (matK) gene, partial cds; chloroplast | 720 | 97.6% | 687.0 | 0.00e+00 | 98.5% |
| 23 | AM920611 | Syngonium auritum plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 702.0 | 0.00e+00 | 98.4% |
| 24 | JQ586651 | Syngonium angustatum voucher BioBot00574 maturase K (matK) gene, partial cds; chloroplast | 711 | 96.3% | 675.0 | 0.00e+00 | 98.3% |
| 25 | JQ586652 | Syngonium angustatum voucher BioBot00575 maturase K (matK) gene, partial cds; chloroplast | 707 | 95.8% | 671.0 | 0.00e+00 | 98.3% |
| 26 | NC_051874 | Zomicarpella amazonica voucher MO:71763b chloroplast, complete genome | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 27 | NC_068800 | Caladium humboldtii isolate MNBHYY chloroplast, complete genome | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 28 | EU886501 | Caladium bicolor tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 29 | ON707031 | Caladium bicolor isolate ESHYY chloroplast, complete genome | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 30 | EU542583 | Caladium bicolor maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 31 | NC_060474 | Caladium bicolor chloroplast, complete sequence | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 32 | AM920610 | Caladium lindenii plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 33 | NC_068801 | Caladium lindenii isolate RMQNY chloroplast, complete genome | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 34 | GU135034 | Syngonium podophyllum voucher J.R. Abbott 24908 (FLAS) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 35 | EU542587 | Scaphispatha gracilis maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 36 | MN046894 | Syngonium angustatum chloroplast, complete genome | 738 | 100.0% | 699.0 | 0.00e+00 | 98.2% |
| 37 | AM920618 | Zomicarpella amazonica plastid partial trnK gene intron and matK gene for maturase K | 727 | 98.5% | 688.0 | 0.00e+00 | 98.2% |
| 38 | KX783790 | Syngonium podophyllum voucher Hosam00170 maturase K (matK) gene, partial cds; chloroplast | 714 | 96.7% | 675.0 | 0.00e+00 | 98.2% |
| 39 | EU542588 | Syngonium angustatum maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 697.0 | 0.00e+00 | 98.1% |
| 40 | OQ289448 | Syngonium neglectum voucher Pedro Acevedo 16054 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 41 | EU542593 | Zomicarpella amazonica maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 42 | AM920614 | Jasarum steyermarkii plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 43 | JN090112 | Syngonium podophyllum voucher PS3007MT01 maturase K (matk) gene, partial cds; chloroplast | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 44 | NC_070391 | Syngonium podophyllum plastid, complete genome | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 45 | AM920615 | Scaphispatha gracilis plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 46 | GU135108 | Syngonium podophyllum voucher S.B. Davis 0922 (FLAS) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 696.0 | 0.00e+00 | 98.1% |
| 47 | OQ289826 | Syngonium neglectum voucher Canek Ledesma 20570 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 693.0 | 0.00e+00 | 98.0% |
| 48 | MH621514 | Syngonium podophyllum voucher Trotta950396 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 693.0 | 0.00e+00 | 98.0% |
| 49 | AM920616 | Ulearum sagittatum plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 684.0 | 0.00e+00 | 97.6% |
| 50 | EU886578 | Typhonodorum lindleyanum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 684.0 | 0.00e+00 | 97.6% |
| 51 | EU542590 | Ulearum sagittatum maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 684.0 | 0.00e+00 | 97.6% |
| 52 | AF387431 | Hapaline sp. HAR 056 trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 738 | 100.0% | 684.0 | 0.00e+00 | 97.6% |
| 53 | AM920636 | Typhonodorum lindleyanum plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 684.0 | 0.00e+00 | 97.6% |
| 54 | KU523442 | Amorphophallus excentricus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 652.0 | 0.00e+00 | 97.6% |
| 55 | AF387429 | Filarum manserichense trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 738 | 100.0% | 681.0 | 0.00e+00 | 97.4% |
| 56 | AM920617 | Filarum manserichense plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 681.0 | 0.00e+00 | 97.4% |
| 57 | EU542585 | Filarum manserichense maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 681.0 | 0.00e+00 | 97.4% |
| 58 | KU523503 | Amorphophallus stuhlmannii maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 59 | KU523418 | Amorphophallus atrorubens maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 60 | KU523426 | Amorphophallus carneus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 61 | KU523512 | Amorphophallus tuberculatus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 62 | KU523459 | Amorphophallus kachinensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 63 | KU523432 | Amorphophallus curvistylis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 649.0 | 0.00e+00 | 97.4% |
| 64 | KU523473 | Amorphophallus mossambicensis maturase K (matK) gene, partial cds; chloroplast | 702 | 95.1% | 648.0 | 0.00e+00 | 97.4% |
| 65 | KU523488 | Amorphophallus pulchellus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 647.0 | 0.00e+00 | 97.4% |
| 66 | KU523492 | Amorphophallus rostratus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 647.0 | 0.00e+00 | 97.4% |
| 67 | KU523460 | Amorphophallus kiusianus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 647.0 | 0.00e+00 | 97.4% |
| 68 | EU542586 | Hapaline benthamiana maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 680.0 | 0.00e+00 | 97.3% |
| 69 | AM920642 | Arophyton buchetii plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 678.0 | 0.00e+00 | 97.3% |
| 70 | NC_051871 | Carlephyton glaucophyllum voucher MO:101527 chloroplast, complete genome | 738 | 100.0% | 678.0 | 0.00e+00 | 97.3% |
| 71 | AM920645 | Colletogyne perrieri plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 678.0 | 0.00e+00 | 97.3% |
| 72 | OL689918 | Carlephyton glaucophyllum voucher MO:Carlsen3387 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 678.0 | 0.00e+00 | 97.3% |
| 73 | AF387387 | Amorphophallus corrugatus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 74 | AF387408 | Amorphophallus napalensis trnK gene, partial intron sequence; and maturase K (matK) gene, partial cds; chloroplast genes for chloroplast products | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 75 | AF387409 | Amorphophallus ochroleucus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 76 | AF387398 | Amorphophallus konjac trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 77 | AF387415 | Amorphophallus rhizomatosus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 78 | KY490473 | Amorphophallus angulatus isolate AM110 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 675.0 | 0.00e+00 | 97.3% |
| 79 | KU523472 | Amorphophallus maximus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 80 | KU523461 | Amorphophallus konkanensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 81 | KU523471 | Amorphophallus manta maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 82 | KU523415 | Amorphophallus antsingyensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 83 | KU523491 | Amorphophallus reflexus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 84 | KU523490 | Amorphophallus ranchanensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 85 | KU523412 | Amorphophallus andranogidroensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 86 | KU523414 | Amorphophallus angustispathus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 87 | KU523509 | Amorphophallus thaiensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 88 | KU523428 | Amorphophallus consimilis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 89 | KU523504 | Amorphophallus sylvaticus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 90 | KU523508 | Amorphophallus terrestris maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 91 | KU523447 | Amorphophallus gomboczianus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 92 | KU523440 | Amorphophallus elliottii maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 93 | KU523417 | Amorphophallus asterostigmatus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 94 | KU523463 | Amorphophallus lanuginosus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 95 | KU523497 | Amorphophallus schmidtiae maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 96 | KU523507 | Amorphophallus tenuistylis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 646.0 | 0.00e+00 | 97.3% |
| 97 | KU523416 | Amorphophallus aphyllus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 644.0 | 0.00e+00 | 97.3% |
| 98 | KU523466 | Amorphophallus longicomus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 644.0 | 0.00e+00 | 97.3% |
| 99 | AM920643 | Carlephyton glaucophyllum plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 676.0 | 0.00e+00 | 97.2% |
| 100 | NC_086582 | Amorphophallus kiusianus chloroplast, complete genome | 738 | 100.0% | 675.0 | 0.00e+00 | 97.2% |
| 101 | KY769273 | Colocasia esculenta chloroplast, complete genome | 738 | 100.0% | 675.0 | 0.00e+00 | 97.2% |
| 102 | PP936071 | Amorphophallus krausei chloroplast, complete genome | 738 | 100.0% | 675.0 | 0.00e+00 | 97.2% |
| 103 | KU523427 | Amorphophallus cicatricifer maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 644.0 | 0.00e+00 | 97.2% |
| 104 | KU523464 | Amorphophallus laoticus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 105 | KU523422 | Amorphophallus boyceanus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 106 | KU523420 | Amorphophallus paeoniifolius var. bangkokensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 107 | KU523446 | Amorphophallus glossophyllus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 108 | KU523486 | Amorphophallus prainii maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 109 | KU523431 | Amorphophallus cruddasianus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 110 | KU523516 | Amorphophallus yuloensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 111 | KU523500 | Amorphophallus sinuatus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 643.0 | 0.00e+00 | 97.2% |
| 112 | KU523449 | Amorphophallus harmandii maturase K (matK) gene, partial cds; chloroplast | 702 | 95.1% | 642.0 | 0.00e+00 | 97.2% |
| 113 | AF387396 | Amorphophallus hirtus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 114 | MT850189 | Amorphophallus albus clone 5 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 115 | MT850196 | Amorphophallus konjac clone 3 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 116 | MT850194 | Amorphophallus konjac clone 1 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 117 | KY490470 | Amorphophallus angulatus isolate AM33 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 118 | MT850195 | Amorphophallus konjac clone 2 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 119 | MT850186 | Amorphophallus albus clone 2 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 120 | MT850197 | Amorphophallus konjac clone 4 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 121 | AF387405 | Amorphophallus maxwellii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 122 | MT850198 | Amorphophallus konjac clone 5 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 123 | AF387401 | Amorphophallus lewallei trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 124 | MT850188 | Amorphophallus albus clone 4 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 125 | MT850185 | Amorphophallus albus clone 1 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 126 | AF387419 | Amorphophallus symonianus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 127 | MT850187 | Amorphophallus albus clone 3 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 672.0 | 0.00e+00 | 97.1% |
| 128 | KU523481 | Amorphophallus pendulus maturase K (matK) gene, partial cds; chloroplast | 701 | 95.0% | 641.0 | 0.00e+00 | 97.1% |
| 129 | EU542582 | Amorphophallus bulbifer maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 130 | NC_067990 | Amorphophallus albus isolate YJ-065 chloroplast, complete genome | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 131 | OR438676 | Amorphophallus albus chloroplast, complete genome | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 132 | NC_086583 | Amorphophallus kachinensis chloroplast, complete genome | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 133 | NC_046702 | Amorphophallus konjac chloroplast, complete genome | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 134 | AM920637 | Peltandra virginica plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 135 | OR438675 | Amorphophallus konjac chloroplast, complete genome | 738 | 100.0% | 672.0 | 0.00e+00 | 97.0% |
| 136 | AF387399 | Amorphophallus krausei trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 137 | MT850200 | Amorphophallus muelleri clone 2 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 138 | AF387384 | Amorphophallus brevispathus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 139 | MT850202 | Amorphophallus muelleri clone 4 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 140 | AF387389 | Amorphophallus dracontioides trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 141 | AF387423 | Amorphophallus yunnanensis trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 142 | MT850204 | Amorphophallus muelleri clone 6 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 143 | AF387388 | Amorphophallus decus-silvae trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 144 | KY490453 | Amorphophallus ranchanensis isolate AM13 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 145 | MT850201 | Amorphophallus muelleri clone 3 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 146 | MT850199 | Amorphophallus muelleri clone 1 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 147 | AF387391 | Amorphophallus eichleri trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 148 | KU523470 | Amorphophallus mangelsdorffii maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 149 | AF387404 | Amorphophallus angolensis trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 150 | AF387406 | Amorphophallus muelleri trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 151 | MT850203 | Amorphophallus muelleri clone 5 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 152 | AF387420 | Amorphophallus taurostigma trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 669.0 | 0.00e+00 | 97.0% |
| 153 | MH551903 | Peltandra virginica isolate OSBAR 000406 maturase K (matK) gene, partial cds; chloroplast | 727 | 98.5% | 661.0 | 0.00e+00 | 97.0% |
| 154 | KU523467 | Amorphophallus longiconnectivus maturase K (matK) gene, partial cds; chloroplast | 707 | 95.8% | 644.0 | 0.00e+00 | 97.0% |
| 155 | KU523423 | Amorphophallus brachyphyllus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 156 | KU523437 | Amorphophallus dzui maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 157 | KU523469 | Amorphophallus macrorhizus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 158 | KU523474 | Amorphophallus myosuroides maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 159 | KU523494 | Amorphophallus saraburensis maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 160 | KU523477 | Amorphophallus obscurus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 161 | KU523453 | Amorphophallus impressus maturase K (matK) gene, partial cds; chloroplast | 703 | 95.3% | 640.0 | 0.00e+00 | 97.0% |
| 162 | PP936070 | Amorphophallus sp. chloroplast, complete genome | 738 | 100.0% | 669.0 | 0.00e+00 | 96.9% |
| 163 | NC_082906 | Amorphophallus yunnanensis chloroplast, complete genome | 738 | 100.0% | 669.0 | 0.00e+00 | 96.9% |
| 164 | OL690107 | Peltandra virginica voucher MO:Carlsen3244 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 669.0 | 0.00e+00 | 96.9% |
| 165 | NC_086626 | Amorphophallus muelleri chloroplast, complete genome | 738 | 100.0% | 669.0 | 0.00e+00 | 96.9% |
| 166 | AM920627 | Protarum sechellarum plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 669.0 | 0.00e+00 | 96.9% |
| 167 | KY490484 | Amorphophallus gigas isolate AM121 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 168 | KU523411 | Amorphophallus amygdaloides maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 169 | MT850190 | Amorphophallus bulbifer clone 1 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 170 | MT850205 | Amorphophallus yuloensis clone 1 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 171 | KU523484 | Amorphophallus plicatus maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 172 | KY490442 | Amorphophallus prainii isolate AM1 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 173 | KY490449 | Amorphophallus hewitii isolate AM9 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 174 | KY490475 | Amorphophallus variabilis isolate AM112 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 175 | AF387422 | Amorphophallus variabilis trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 176 | MT850209 | Amorphophallus yuloensis clone 5 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 177 | MT850208 | Amorphophallus yuloensis clone 4 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 178 | KY490487 | Amorphophallus prainii isolate AM124 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 179 | KY490443 | Amorphophallus hewitii isolate AM3 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 180 | KY490447 | Amorphophallus sp. AM7 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 181 | KY490457 | Amorphophallus hewitii isolate AM18 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 182 | KU523436 | Amorphophallus dunnii maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 183 | KY490446 | Amorphophallus hewitii isolate AM6 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 184 | AF387394 | Amorphophallus henryi trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 185 | MT850206 | Amorphophallus yuloensis clone 2 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 186 | MT850192 | Amorphophallus bulbifer clone 3 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 187 | KY490479 | Amorphophallus titanum isolate AM116 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 188 | KY490451 | Amorphophallus sp. AM11 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 189 | AF387416 | Amorphophallus sagittarius trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 190 | AF387421 | Amorphophallus titanum trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 191 | KY490478 | Amorphophallus boyceanus isolate AM115 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 192 | KY490466 | Amorphophallus titanum isolate AM27 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 193 | AJ581391 | Amorphophallus titanum plastid partial matK gene for maturase K, specimen voucher Chase 2968 K | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 194 | KU523487 | Amorphophallus prolificus maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 195 | KU523425 | Amorphophallus calabaricus maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 196 | MT850193 | Amorphophallus bulbifer clone 4 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 197 | KU523450 | Amorphophallus hewitii maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 198 | MT850191 | Amorphophallus bulbifer clone 2 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 199 | AF387381 | Amorphophallus coaetaneus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 200 | MT850207 | Amorphophallus yuloensis clone 3 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 201 | KU523445 | Amorphophallus gigas maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 202 | KY490444 | Amorphophallus hewitii isolate AM4 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 666.0 | 0.00e+00 | 96.9% |
| 203 | NC_072945 | Amorphophallus coaetaneus chloroplast, complete genome | 738 | 100.0% | 666.0 | 0.00e+00 | 96.7% |
| 204 | NC_082907 | Amorphophallus krausei chloroplast, complete genome | 738 | 100.0% | 666.0 | 0.00e+00 | 96.7% |
| 205 | NC_056329 | Amorphophallus titanum voucher MO:103059 chloroplast, complete genome | 738 | 100.0% | 666.0 | 0.00e+00 | 96.7% |
| 206 | OR416863 | Amorphophallus krausei chloroplast, complete genome | 738 | 100.0% | 666.0 | 0.00e+00 | 96.7% |
| 207 | AM920607 | Amorphophallus hottae plastid partial trnK gene intron and matK gene for maturase K | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 208 | AF387397 | Amorphophallus hottae trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 209 | KY490460 | Amorphophallus tinekeae isolate AM21 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 210 | KY490472 | Amorphophallus julaihii isolate AM109 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 211 | KY490463 | Amorphophallus hottae isolate AM24 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 212 | KY490486 | Amorphophallus hewitii isolate AM123 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 213 | KY490465 | Amorphophallus hewitii isolate AM26 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 214 | AF387390 | Amorphophallus eburneus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 215 | KY490485 | Amorphophallus infundibuliformis isolate AM122 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 216 | KY490461 | Amorphophallus borneensis isolate AM22 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 217 | AF387411 | Amorphophallus palawanensis trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 218 | KU523502 | Amorphophallus spectabilis maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 219 | KU523510 | Amorphophallus tinekeae maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 220 | AF387385 | Amorphophallus canaliculatus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 221 | KY490459 | Amorphophallus brachyphyllus isolate AM20 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 222 | KY490476 | Amorphophallus discophorus isolate AM113 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 223 | KU523496 | Amorphophallus scaber maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 224 | KY490471 | Amorphophallus hewitii isolate AM34 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 225 | KY490477 | Amorphophallus declinatus isolate AM114 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 226 | AF387386 | Amorphophallus cirrifer trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 227 | KY490452 | Amorphophallus infundibuliformis isolate AM12 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 228 | AF387412 | Amorphophallus pingbianensis trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 229 | AF387383 | Amorphophallus beccarii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 230 | KY490464 | Amorphophallus lambii isolate AM25 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 231 | KY490455 | Amorphophallus eburneus isolate AM15 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 232 | AF387403 | Amorphophallus margaritifer trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 233 | KY490454 | Amorphophallus hewitii isolate AM14 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 234 | AF387424 | Amorphophallus zenkeri trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 235 | AB088777 | Amorphophallus paeoniifolius var. campanulatus chloroplast matK gene for maturase, complete cds | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 236 | KU523435 | Amorphophallus discophorus maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 237 | KY490458 | Amorphophallus eburneus isolate AM19 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 238 | KY490456 | Amorphophallus pendulus isolate AM16 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 239 | AF387400 | Amorphophallus lambii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 240 | AF387393 | Amorphophallus galbra trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 241 | PP921943 | Amorphophallus paeoniifolius voucher KM 0105/24 maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 242 | AF387392 | Amorphophallus commutatus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 243 | AF387410 | Amorphophallus paeoniifolius trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 663.0 | 0.00e+00 | 96.7% |
| 244 | MW035339 | Amorphophallus mysorensis maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 649.0 | 0.00e+00 | 96.7% |
| 245 | MW035330 | Amorphophallus paeoniifolius var. campanulatus maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 649.0 | 0.00e+00 | 96.7% |
| 246 | MW035338 | Amorphophallus nicolsonianus maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 649.0 | 0.00e+00 | 96.7% |
| 247 | NC_086855 | Amorphophallus tonkinensis chloroplast, complete genome | 738 | 100.0% | 663.0 | 0.00e+00 | 96.6% |
| 248 | NC_086625 | Amorphophallus paeoniifolius chloroplast, complete genome | 738 | 100.0% | 663.0 | 0.00e+00 | 96.6% |
| 249 | NC_060475 | Leucocasia gigantea chloroplast, complete sequence | 738 | 100.0% | 663.0 | 0.00e+00 | 96.6% |
| 250 | EU886588 | Protarum sechellarum tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 662.0 | 0.00e+00 | 96.6% |
| 251 | AF387426 | Pseudodracontium lanceolatum trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 252 | KY490468 | Amorphophallus sp. AM30 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 253 | AF387380 | Amorphophallus ankarana trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 254 | AF387425 | Pseudodracontium harmandii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 255 | KU523421 | Amorphophallus borneensis maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 256 | AF387413 | Amorphophallus pusillus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 257 | KY490474 | Amorphophallus costatus isolate AM111 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 258 | KU523476 | Amorphophallus niahensis maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 259 | KY490450 | Amorphophallus sp. AM10 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 260 | KY490481 | Amorphophallus dactylifer isolate AM118 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 261 | KY490445 | Amorphophallus infundibuliformis isolate AM5 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 660.0 | 0.00e+00 | 96.6% |
| 262 | MH332517 | Amorphophallus paeoniifolius var. campanulatus voucher gp-158 maturase K (matK) gene, partial cds; chloroplast | 712 | 96.5% | 640.0 | 0.00e+00 | 96.6% |
| 263 | JQ238893 | Leucocasia gigantea tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 660.0 | 0.00e+00 | 96.5% |
| 264 | HM850480 | Arum italicum maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 660.0 | 0.00e+00 | 96.5% |
| 265 | OP279444 | Anubias barteri isolate JYH087 chloroplast, complete genome | 738 | 100.0% | 658.0 | 0.00e+00 | 96.5% |
| 266 | NC_068131 | Anubias barteri isolate JYH085 chloroplast, complete genome | 738 | 100.0% | 658.0 | 0.00e+00 | 96.5% |
| 267 | KU523475 | Amorphophallus natolii maturase K (matK) gene, partial cds; chloroplast | 735 | 99.6% | 658.0 | 0.00e+00 | 96.5% |
| 268 | MN046884 | Anubias heterophylla chloroplast, complete genome | 738 | 100.0% | 658.0 | 0.00e+00 | 96.5% |
| 269 | AF387418 | Amorphophallus sumawongii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 657.0 | 0.00e+00 | 96.5% |
| 270 | KY490482 | Amorphophallus atroviridis isolate AM119 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 657.0 | 0.00e+00 | 96.5% |
| 271 | AF387407 | Amorphophallus napiger trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 657.0 | 0.00e+00 | 96.5% |
| 272 | AF387395 | Amorphophallus hirsutus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 657.0 | 0.00e+00 | 96.5% |
| 273 | AF387379 | Amorphophallus abyssinicus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 657.0 | 0.00e+00 | 96.5% |
| 274 | MW035331 | Amorphophallus commutatus var. wayanadensis maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 646.0 | 0.00e+00 | 96.5% |
| 275 | MW035332 | Amorphophallus hohenackeri maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 646.0 | 0.00e+00 | 96.5% |
| 276 | MW035329 | Amorphophallus sylvaticus maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 646.0 | 0.00e+00 | 96.5% |
| 277 | MW035337 | Amorphophallus bulbifer maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 643.0 | 0.00e+00 | 96.4% |
| 278 | JQ238820 | Alocasia brancifolia tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 657.0 | 0.00e+00 | 96.3% |
| 279 | GU255972 | Typhonium aff. brownii Ford-4782 voucher A. Ford 4782 (CNS) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 657.0 | 0.00e+00 | 96.3% |
| 280 | EU886538 | Typhonium brownii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 657.0 | 0.00e+00 | 96.3% |
| 281 | EU886537 | Typhonium eliosurum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 657.0 | 0.00e+00 | 96.3% |
| 282 | GU255971 | Typhonium aff. brownii Gray-9276 voucher B. Gray 9276 (CNS) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 657.0 | 0.00e+00 | 96.3% |
| 283 | NC_062430 | Anubias hastifolia chloroplast, complete genome | 738 | 100.0% | 655.0 | 0.00e+00 | 96.3% |
| 284 | AF387382 | Amorphophallus baumannii trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 654.0 | 0.00e+00 | 96.3% |
| 285 | AF387402 | Amorphophallus longituberosus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 654.0 | 0.00e+00 | 96.3% |
| 286 | AM920608 | Pseudodracontium lacourii plastid partial trnK gene intron and matK gene for maturase K | 735 | 99.6% | 654.0 | 0.00e+00 | 96.3% |
| 287 | MW035336 | Amorphophallus commutatus var. commutatus maturase K (matK) gene, partial cds; chloroplast | 721 | 97.7% | 640.0 | 0.00e+00 | 96.3% |
| 288 | JQ238882 | Alocasia sp. ridleythai tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 289 | MW961254 | Colocasia esculenta isolate YY-GX-1-Y-1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 290 | JQ238833 | Alocasia inornata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 291 | PP817740 | Colocasia esculenta isolate CESVN15_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 292 | OP245418 | Colocasia esculenta isolate 65B maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 293 | PP817739 | Colocasia esculenta isolate CESTH07_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 294 | PP817745 | Colocasia oresbia isolate CORMY01_wild chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 295 | GU255977 | Typhonium sp. Prince Regent voucher R.L. Barrett & M.D. Barrett RLB 1716 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 296 | PP817748 | Colocasia sp. (in: monocots) isolate CxVN01_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 297 | KY196229 | Vietnamocasia dauae voucher LY654 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 298 | PP817747 | Colocasia spongifolia isolate CSFVN01_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 299 | JQ238830 | Alocasia hollrungii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 300 | JQ238835 | Alocasia lauterbachiana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 301 | MT447084 | Colocasia esculenta cultivar redbud chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 302 | JQ238885 | Alocasia watsoniana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 303 | JQ238850 | Alocasia peltata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 304 | MK982571 | Colocasia esculenta isolate 1806 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 305 | AM920625 | Remusatia vivipara plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 306 | PP817746 | Colocasia oresbia isolate CORMY02_wild chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 307 | LT995105 | Colocasia esculenta tRNA-Lys (trnK) gene, partial cds; tRNA-Lys (trnK) intron, partial sequence; maturase K (matK) gene, complete cds, isolate ARA221 | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 308 | JQ238897 | Remusatia vivipara tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 309 | OP589403 | Colocasia esculenta chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 310 | JQ238834 | Alocasia korthalsii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 311 | JN105690 | Colocasia esculenta isolate RR chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 312 | PP817735 | Colocasia esculenta isolate CESBD03_wild haplogroup CI chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 313 | JQ238892 | Colocasia fontanesii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 314 | AM920622 | Colocasia esculenta plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 315 | PP817742 | Colocasia formosana isolate CFOTW03_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 316 | LC851499 | Colocasia esculenta CSW240710 chloroplast DNA, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 317 | LC661687 | Colocasia esculenta 2019-Oyama-01 chloroplast matK gene for maturase K, partial cds | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 318 | GU255985 | Typhonium russell-smithii voucher I. Cowie 104311 (DNA) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 319 | JQ238818 | Alocasia boa tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 320 | JQ238832 | Alocasia infernalis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 321 | JQ238845 | Alocasia monticola tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 322 | JQ238895 | Colocasia sp. Boyce s.n. tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 323 | KY196230 | Vietnamocasia dauae voucher LY655 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 324 | JQ238859 | Alocasia reversa tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 325 | PP817738 | Colocasia esculenta isolate CESTH06_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 326 | PP817744 | Colocasia lihengiae isolate CLIVN05_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 327 | JQ238821 | Alocasia brisbanensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 328 | MT447085 | Colocasia esculenta cultivar lipu chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 329 | JQ238894 | Colocasia menglaensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 330 | NC_016753 | Colocasia esculenta chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 331 | JQ238886 | Alocasia watsoniana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 332 | PP811809 | Colocasia esculenta chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 333 | JQ238880 | Alocasia sp. kelamensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 334 | JQ238890 | Colocasia esculenta tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 335 | HM850481 | Arisarum vulgare maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 336 | PP817743 | Colocasia lihengiae isolate CLIVN04_wild haplogroup CIII chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 337 | PP475493 | Colocasia esculenta isolate CESAU24_wild haplogroup Clade III chloroplast, complete genome | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 338 | MK982572 | Colocasia esculenta isolate 1807 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 339 | LC767269 | Colocasia esculenta Taimo chloroplast DNA, complete sequence | 738 | 100.0% | 654.0 | 0.00e+00 | 96.2% |
| 340 | AM920595 | Callopsis volkensii plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 652.0 | 0.00e+00 | 96.2% |
| 341 | AF387417 | Amorphophallus smithsonianus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 651.0 | 0.00e+00 | 96.2% |
| 342 | GU255981 | Typhonium nudibaccatum voucher R.L. Barrett 3957 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 653.0 | 0.00e+00 | 96.1% |
| 343 | JQ238854 | Alocasia princeps tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 344 | JQ238838 | Alocasia longiloba tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 345 | JQ238889 | Colocasia affinis var. jenningsii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 346 | JQ238875 | Alocasia sp. MPM3 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 347 | LC461938 | Alocasia macrorrhizos chloroplast gene for maturase K, partial cds, isolate: CHULA-116 | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 348 | AM920619 | Arisarum vulgare plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 349 | JQ238841 | Alocasia macrorrhizos tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 350 | JQ238858 | Alocasia reginula tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 351 | JQ238857 | Alocasia reginae tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 352 | JQ238816 | Alocasia atropurpurea tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 353 | JQ238819 | Alocasia boyceana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 354 | JQ238860 | Alocasia ridleyi tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 355 | PP817734 | Colocasia esculenta isolate CESBD02_wild haplogroup CI chloroplast, complete genome | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 356 | JQ238855 | Alocasia principiculus tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 357 | JQ238852 | Alocasia plumbea tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 358 | JQ238843 | Alocasia melo tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 359 | JQ238842 | Alocasia maquilingensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 360 | JQ238826 | Alocasia cuprea tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 361 | JQ238840 | Alocasia lowii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 362 | JQ238828 | Alocasia grandis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 363 | NC_051952 | Steudnera colocasiifolia voucher MO:77954a chloroplast, complete genome | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 364 | GU135110 | Colocasia esculenta voucher S.B. Davis 1225 (FLAS) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 365 | JQ238864 | Alocasia sanderiana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 366 | JQ238866 | Alocasia scabriuscula tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 367 | JQ238853 | Alocasia portei tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 368 | JQ238823 | Alocasia clypeolata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 369 | JQ238814 | Alocasia alba tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 370 | JQ238861 | Alocasia robusta tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 371 | GU255975 | Typhonium alismifolium voucher B. Gray 9146 (CNS) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 372 | JQ238865 | Alocasia sarawakensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 373 | JQ238837 | Alocasia longiloba tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 374 | JQ238867 | Alocasia scalprum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 375 | AM920623 | Steudnera colocasiifolia plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 376 | JQ238899 | Steudnera kerrii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 377 | JQ238891 | Colocasia fallax tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 378 | JQ238898 | Steudnera assamica tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 379 | JQ238856 | Alocasia ramosii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 380 | JQ238829 | Alocasia heterophylla tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 381 | OL537944 | Remusatia vivipara voucher BRIT:Gostel551 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 382 | JQ238872 | Alocasia sp. Kerby tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 383 | JQ238862 | Alocasia robusta tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 384 | JQ238877 | Alocasia sp. Septier tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 385 | JQ238873 | Alocasia sp. MPM1 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 386 | JQ238874 | Alocasia sp. MPM2 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 387 | GU135020 | Colocasia esculenta voucher J.R. Abbott 24708 (FLAS) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 651.0 | 0.00e+00 | 96.1% |
| 388 | AM920578 | Anubias barteri plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 649.0 | 0.00e+00 | 96.1% |
| 389 | AF387414 | Amorphophallus pygmaeus trnK gene, partial intron sequence; and maturase K (matK) gene, complete cds; chloroplast genes for chloroplast products | 735 | 99.6% | 648.0 | 0.00e+00 | 96.1% |
| 390 | KY490480 | Amorphophallus albispathus isolate AM117 maturase K (matK) gene, complete cds; chloroplast | 735 | 99.6% | 648.0 | 0.00e+00 | 96.1% |
| 391 | GU255976 | Typhonium wilbertii voucher A. Ford 2544 (CNS) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 649.0 | 0.00e+00 | 95.9% |
| 392 | EU886579 | Alocasia cucullata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 393 | MW961235 | Alocasia macrorrhizos isolate HY-GX-1-KJ-1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 394 | PP817741 | Colocasia fallax isolate CFABD01_wild chloroplast, complete genome | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 395 | JQ238871 | Alocasia sp. Gomantong tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 396 | MK982637 | Alocasia cucullata isolate 652 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 397 | JQ238817 | Alocasia beccarii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 398 | JQ238844 | Alocasia micholitziana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 399 | MK982574 | Alocasia cucullata isolate 1811 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 400 | OQ289283 | Arisaema macrospathum voucher Raul Alvarez 2460 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 401 | JQ238870 | Alocasia sp. Bo07 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 402 | JQ238813 | Alocasia acuminata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 403 | JQ238822 | Alocasia chaii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 404 | JQ238839 | Alocasia longiloba tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 405 | JN407093 | Alocasia macrorrhizos isolate shawpc0589K maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 406 | JQ238879 | Alocasia sp. inopinata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 407 | MK982566 | Alocasia cucullata isolate 1792 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 408 | AM920624 | Alocasia odora plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 409 | JQ238849 | Alocasia pangeran tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 410 | GU255979 | Typhonium sp. Kununurra voucher R.L. Barrett 3069 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 411 | JQ238846 | Alocasia nebula tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 412 | JN407091 | Alocasia macrorrhizos isolate shawpc0568K maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 413 | MK982575 | Alocasia cucullata isolate 1812 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 414 | MK982565 | Alocasia cucullata isolate 1791 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 415 | MK982638 | Alocasia cucullata isolate 653 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 416 | JQ238868 | Alocasia sinuata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 417 | JQ238888 | Alocasia zebrina tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 418 | JQ238824 | Alocasia cucullata tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 419 | MK982573 | Alocasia cucullata isolate 1810 maturase K (matK) gene, partial cds; mitochondrial. | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 420 | JQ238878 | Alocasia sp. Setiam tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 421 | MK636779 | Alocasia fornicata chloroplast, complete genome | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 422 | KC466575 | Arisaema macrospathum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.9% |
| 423 | EU886586 | Steudnera discolor tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 647.0 | 0.00e+00 | 95.9% |
| 424 | EU886576 | Typhonium angustilobum tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 647.0 | 0.00e+00 | 95.9% |
| 425 | EU886582 | Arisarum vulgare tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 647.0 | 0.00e+00 | 95.9% |
| 426 | KX676960 | Calla palustris voucher HERB0060 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 427 | AM920641 | Calla palustris plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 428 | HQ687765 | Calla palustris tRNA-Lys (trnK) and maturase K (matK) gene, partial sequence; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 429 | MN046887 | Calla palustris chloroplast, complete genome | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 430 | AM920639 | Cercestis mirabilis plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 431 | KF632782 | Calla palustris voucher C945 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 432 | MK519723 | Calla palustris voucher v0258985WIS maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.9% |
| 433 | JQ238831 | Englerarum hypnosum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 648.0 | 0.00e+00 | 95.8% |
| 434 | GU255974 | Typhonium angustilobum voucher B. Gray 9277 (CNS) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.8% |
| 435 | GU255973 | Typhonium peltandroides voucher M.D. Barrett 599 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.8% |
| 436 | OQ289894 | Arisaema macrospathum voucher Canek Ledesma 20671 (MEXU, US) maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 646.0 | 0.00e+00 | 95.8% |
| 437 | MN046885 | Arisaema franchetianum chloroplast, complete genome | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 438 | KT444677 | Arisaema thunbergii subsp. geomundoense isolate GG2 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 439 | KT444684 | Arisaema thunbergii isolate JN2 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 440 | GU255978 | Typhonium sp. Prince Regent voucher M.D. Barrett 1033 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 441 | KC466573 | Arisaema dracontium tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 442 | KT444679 | Arisaema thunbergii isolate MO1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 443 | EU886580 | Alocasia gageana tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 444 | JQ238884 | Alocasia warburgii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 445 | PV068279 | Arisaema lackneri chloroplast, complete genome | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 446 | JQ238848 | Alocasia odora tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 447 | KT444681 | Arisaema thunbergii isolate MO3 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 448 | MW451769 | Typhonium trifoliatum chloroplast, complete genome | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 449 | MK509445 | Arisaema dracontium voucher v0180418WIS maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 450 | EU886502 | Arisaema speciosum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 451 | JQ238869 | Alocasia sp. Bo011 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 452 | LC704914 | Arisaema thunbergii subsp. urashima P3036 chloroplast matK gene for maturase K, partial cds | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 453 | KT444676 | Arisaema thunbergii subsp. geomundoense isolate GG1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 454 | LC661689 | Alocasia odora 2021-OKIU-02 chloroplast matK gene for maturase K, partial cds | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 455 | KT444683 | Arisaema thunbergii isolate JN1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 456 | NC_056328 | Arisarum simorrhinum voucher MO:101519 chloroplast, complete genome | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 457 | EU886534 | Theriophonum dalzellii tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 458 | JQ238825 | Alocasia culionensis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 459 | KT444678 | Arisaema thunbergii subsp. geomundoense isolate GG3 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 460 | MG217000 | Arisaema dracontium voucher MT00179125 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 461 | KT444680 | Arisaema thunbergii isolate MO2 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.8% |
| 462 | EF173529 | Cercestis mirabilis voucher Goncalves 616 (UB) maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 643.0 | 0.00e+00 | 95.8% |
| 463 | MN046889 | Montrichardia arborescens chloroplast, complete genome | 738 | 100.0% | 643.0 | 0.00e+00 | 95.8% |
| 464 | AM920640 | Montrichardia arborescens plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 643.0 | 0.00e+00 | 95.8% |
| 465 | LT995102 | Montrichardia linifera tRNA-Lys (trnK) gene, partial cds; tRNA-Lys (trnK) intron, partial sequence; maturase K (matK) gene, complete cds, isolate ARA217 | 738 | 100.0% | 643.0 | 0.00e+00 | 95.8% |
| 466 | GU255980 | Typhonium sp. Morgan River voucher M.D. Barrett & R.L. Barrett MDB 2265 (PERTH) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 645.0 | 0.00e+00 | 95.7% |
| 467 | GU255982 | Typhonium praetermissum voucher Hay s.n. 16.10.1996 (NSW) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 644.0 | 0.00e+00 | 95.7% |
| 468 | GU067607 | Arum palaestinum trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 469 | KT025781 | Arisaema heterophyllum clone AH_KY maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 470 | MN046882 | Alocasia navicularis chloroplast, complete genome | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 471 | KT025782 | Arisaema heterophyllum clone AH_TY maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 472 | JQ238847 | Alocasia nycteris tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 473 | GU067597 | Arum dioscoridis trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 474 | FN668801 | Arum italicum chloroplast partial matK gene for maturase K, specimen voucher MIB:zpl:01660 | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 475 | MZ424448 | Arisaema heterophyllum chloroplast, complete genome | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 476 | JN894020 | Arum maculatum isolate NMW2077 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 477 | KT025780 | Arisaema heterophyllum clone AH_SC maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 478 | KT025785 | Arisaema heterophyllum clone AH_GP maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 479 | EU886581 | Alocasia navicularis tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 480 | KT025779 | Arisaema erubescens clone AE_QS3 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 481 | EU886535 | Theriophonum infaustum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 482 | EU886512 | Arum balansanum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 483 | GQ434306 | Arisaema heterophyllum voucher PS3010MT01 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 484 | KT025778 | Arisaema erubescens clone AE_QS2 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 485 | KT025777 | Arisaema erubescens clone AE_GS1 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 486 | JN090120 | Arisaema erubescens voucher PS3013MT01 maturase K (matk) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 487 | NC_051541 | Arisaema erubescens chloroplast, complete genome | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 488 | KT025784 | Arisaema heterophyllum clone AH_AS maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 489 | EU886516 | Arum concinnatum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 490 | KT025783 | Arisaema heterophyllum clone AH_CY maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 491 | NC_063965 | Arisaema heterophyllum chloroplast, complete genome | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 492 | JN090114 | Arisaema heterophyllum voucher PS3010MT01 maturase K (matk) gene, partial cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 493 | KC466574 | Arisaema heterophyllum tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 494 | NC_065735 | Arisaema flavum chloroplast, complete genome | 738 | 100.0% | 642.0 | 0.00e+00 | 95.7% |
| 495 | EU886584 | Remusatia vivipara tRNA-Lys (trnK) gene, partial sequence; and maturase K-like (matK) gene, complete sequence; chloroplast | 738 | 100.0% | 641.0 | 0.00e+00 | 95.7% |
| 496 | MK262738 | Aglaonema hybrid cultivar cultivar Red Vein chloroplast, complete genome | 738 | 100.0% | 640.0 | 0.00e+00 | 95.7% |
| 497 | KR270497 | Montrichardia arborescens voucher COAH:67023 maturase K (matK) gene, partial cds; chloroplast | 738 | 100.0% | 640.0 | 0.00e+00 | 95.7% |
| 498 | AM920580 | Aglaodorum griffithii plastid partial trnK gene intron and matK gene for maturase K | 738 | 100.0% | 640.0 | 0.00e+00 | 95.7% |
| 499 | JQ238881 | Alocasia sp. kulat tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 643.0 | 0.00e+00 | 95.5% |
| 500 | JQ238836 | Alocasia longiloba tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast | 738 | 100.0% | 640.0 | 0.00e+00 | 95.5% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Nicotiana tabacum | - | - | - | - | - |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1C:
The reference database is likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
Flag 5.1C:
The reference database is likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Planta at the given locus matK.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus matK
Flag 5.3C:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: No species in genus have been observed in the country of origin
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus matK
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 20 sequences in the reference database for Nicotiana tabacum at the given locus matK.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus matK
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus matK
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |